View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_58 (Length: 317)
Name: NF6871A_low_58
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_58 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 154 - 317
Target Start/End: Original strand, 31658583 - 31658746
Alignment:
| Q |
154 |
ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaatgatt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658583 |
ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaatgatt |
31658682 |
T |
 |
| Q |
254 |
caatcgatgatagcatagtggcatgtatcaaataatcaaaacaaaattcaaagttacatgatat |
317 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
31658683 |
caatcgatgatagcatagtggcacgtctcaaataatcaaaataaacttcaaagttacatgatat |
31658746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 16 - 53
Target Start/End: Original strand, 31658521 - 31658558
Alignment:
| Q |
16 |
gacatcataagttaaacgatcaaataaatctcccatta |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658521 |
gacatcataagttaaacgatcaaataaatctcccatta |
31658558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University