View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6871A_low_80 (Length: 292)
Name: NF6871A_low_80
Description: NF6871A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6871A_low_80 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 32907354 - 32907519
Alignment:
| Q |
1 |
gaatgaataaatcaatgaaaatcctgacaaaatactctcactttat--cctatattatgtgtgaaccactcaataatcctcccattaattgtcactcctc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32907354 |
gaatgaataaatcaatgaaaatcctgacaaaatactctcactttatatcctatattatgtatgaaccactcaataatcctcccactaattgtcactcctc |
32907453 |
T |
|
| Q |
99 |
tcttggttagcaaatcagcagaattgttggcttccctattcactcctctcttttgtattttctgtc |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32907454 |
tcttggttagcaaatcagcagaattgttggcttccctgttcactcctctcttttgtattttctgtc |
32907519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 177 - 292
Target Start/End: Original strand, 32907580 - 32907695
Alignment:
| Q |
177 |
tgtagcatgtcttaaaacttaatatattaaaccttatatggagggtattctgccattggatggatttgcttccaggtaactgtaatgaaatactactggc |
276 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32907580 |
tgtagcatgtcttaaaacttaatgtattaaactttatatggagggtattcttccattggatggatttgcttccaggtaattgtaatgaaatactactggc |
32907679 |
T |
|
| Q |
277 |
tttacactattgaaat |
292 |
Q |
| |
|
|||| ||||| ||||| |
|
|
| T |
32907680 |
tttatactatcgaaat |
32907695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University