View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_high_15 (Length: 294)
Name: NF6872A_high_15
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 51295404 - 51295670
Alignment:
| Q |
1 |
accgattacttgttatgaagcactacacaacaaagggaaagaaaaattaacgatctcttttatctaaagtaggtatcaacacaccaaacgaaaatcttaa |
100 |
Q |
| |
|
|||| |||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51295404 |
accggttacctgttatggagcactacacaacaaagggaaagaaaagttaacgatctcttttatctaaagtaggtatcaacacaccaaacgaaaatcttaa |
51295503 |
T |
 |
| Q |
101 |
agagatgccataagtatatgggtttttctcatttcaccctttcatgccaaacattattgagtttgatcatgtgtcacttattgtgagatagaggggtgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51295504 |
agagatgccataagtatatgggtttttctcatttcaccctttcacgccaaacattattgagtttgatcatgtgtcac---------------ggggtgaa |
51295588 |
T |
 |
| Q |
201 |
cttctatatttggtcttacttgtcataattgattattctatatcatattaatttttcatattagaattgatgtgtggatatt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51295589 |
cttctatatttggtcttacttgtcataattgattattctatatcatattaattttttatattagaattgatgtgtggatatt |
51295670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University