View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_high_22 (Length: 240)
Name: NF6872A_high_22
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_high_22 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 6 - 240
Target Start/End: Original strand, 51294975 - 51295209
Alignment:
| Q |
6 |
agtaagcacatcacatgaatgaaattaactttgcagtcatatagctagatcatttggtgtctaccttataacgttctacttttctagtgcgaatctgtaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294975 |
agtaagcacatcacatgaatgaaattaactttgcagtcatatagctagatcatttggtgtctaccttataacgttctacttttctagtgcgaatctgtaa |
51295074 |
T |
 |
| Q |
106 |
ctttggtatacctacagaaaaagcactggattccctttcctttgtgtcaatatttcagctttagggacaacagtaaccctcattgttctcgtatttatcc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51295075 |
ctttggtatacctacagaaaaagcactggattccctttcctttgtgtcaatatttcagcttttgggacaacagtaaccctcattgttctcgtatttatcc |
51295174 |
T |
 |
| Q |
206 |
gattattagattatagttagttagagaagcttggt |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
51295175 |
gattattagactatagttagttagagaagcttggt |
51295209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University