View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_119 (Length: 290)
Name: NF6872A_low_119
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_119 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 118 - 267
Target Start/End: Complemental strand, 36603860 - 36603711
Alignment:
| Q |
118 |
ccatttccttaaagaagtcaagtgaccaagatgtgaagattaagtttagcttaagaaattcttccaccaaatcagcttataaggctgtttctcatgattt |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36603860 |
ccatttacttaaagaagtcaagtgaccaagatgtgaagattaagtttagcttaagaaattcttccaccaaatcagcttataaggctgtttctcatggttt |
36603761 |
T |
|
| Q |
218 |
ggttaatgattggaataaagggatagtgaactttgatgtgaaaatgttgg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36603760 |
ggttaatgattggaataaagggatagtgaactttgatgtgaaaatgttgg |
36603711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 3 - 128
Target Start/End: Original strand, 36605991 - 36606116
Alignment:
| Q |
3 |
agctttggctggctaactttatgaggcctattagttggcaagcttgctggactaacttcacaaacagacttttttccagaaatggaaagtgaatgtttga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605991 |
agctttggctggctaactttatgaggcctattatttggcaagcttactggactaacttcacaaacagacttttttccagaaatggaaagtgaatgtttga |
36606090 |
T |
|
| Q |
103 |
gagaattgatcgaagccatttcctta |
128 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
36606091 |
gagaattgattgaagccatttcctta |
36606116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 209 - 251
Target Start/End: Complemental strand, 36599477 - 36599435
Alignment:
| Q |
209 |
tcatgatttggttaatgattggaataaagggatagtgaacttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
36599477 |
tcatgatttggttaatgattggaataaagggatactgtacttt |
36599435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University