View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_123 (Length: 288)
Name: NF6872A_low_123
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_123 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 1435210 - 1435146
Alignment:
| Q |
1 |
gctgaactttcgattggtacccatgattctggtccttcttttcttttttctgataatgatggaca |
65 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
1435210 |
gctgaactttggattggtacccatgattctggtccttcttttcttgtttctgatgatgatggaca |
1435146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 286
Target Start/End: Complemental strand, 1432867 - 1432759
Alignment:
| Q |
179 |
ttagatttatggatgtagggaaccaatttaactaactcacgtgttcggattacggtcctg-ccatggtttatttctgtcagtctcctagacaggctttga |
277 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||| |||| |||| |||| || |||||||| |||||||||| ||||| |||| || ||| | |
|
|
| T |
1432867 |
ttagatttatggatgtagggaatcaatttagttaactcaaaagttcagattttggtcttgcccatggttcatttctgtcattctccaagacgggatttta |
1432768 |
T |
|
| Q |
278 |
attctgctt |
286 |
Q |
| |
|
|| |||||| |
|
|
| T |
1432767 |
atactgctt |
1432759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University