View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_16 (Length: 442)
Name: NF6872A_low_16
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 22 - 433
Target Start/End: Complemental strand, 29427887 - 29427477
Alignment:
| Q |
22 |
acataatgtacgattgtgcattcatttagttaccactcatctagaaaaccttcactagggacgtttctgttgtaccattttgtatcccgtgttaatcacc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29427887 |
acataatgtacgattgtgcattcatttagttaccactcatctagaaaaccttcactagggacgtttctgttgtaccattttgtatcccgtgttaatcacc |
29427788 |
T |
|
| Q |
122 |
aacccttttcatgtcttgtatgcacataagcaagttattaagcacacggttggatatcgtacacgtgccaatatggcattgttagtagctactgaaaatc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29427787 |
aacccttttcatgtcttgtatgcacataagca-gttattaagcacacggttggatatcgtacacgtgccaatatggcattgttagtagctactgaaaatc |
29427689 |
T |
|
| Q |
222 |
aggttggtacacattgaaatttctgtgtagcaaacaacttttaccttggacatcatgtgtatttgtgctcactgcaccaaggaatgttgtcagatgaaga |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29427688 |
aggttggtacacattgaaatttctgtgtagcaaacaacttttaccttggacatcatttgtatttgtgctcactgcaccaaggaatgttgtcagatgaaga |
29427589 |
T |
|
| Q |
322 |
ggcgcagcaaataagataacagatctaaatatcagccttgttatctaaaggagataggatcaaatggcaccttggtgtcaaattaaacttggacgccaaa |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29427588 |
ggcgcagcaaataagataacagatctaaatatcagccttgttatctaaaggagataggatcaaatggcaccttggtgtcaaattaaacttggacgccaaa |
29427489 |
T |
|
| Q |
422 |
tcctattcatct |
433 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29427488 |
tcctattcatct |
29427477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University