View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_171 (Length: 254)
Name: NF6872A_low_171
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_171 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 39684279 - 39684048
Alignment:
| Q |
18 |
acatcaggaggcaaa-tcaatctatatttgttcaattttctcatcctttagatatgaagataatgcttaatgaaggaccttggaattttgagaacatttc |
116 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39684279 |
acataaggaggcaaagtcaatctatatttgttcaattttctcatcctttagatatgaagataatgcttaatgaaggaccttggaattttgagaacatttc |
39684180 |
T |
 |
| Q |
117 |
ttggtggttgatagagtgaagattggggttgctattaaggagatactgtaatttcatgtggatttttgggtgcaatttaccaacaggcatgatgttcgag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39684179 |
ttggtggttgatagagtgaagattggggttgctattaaggagataccgtaatttcatgtggatttttgggtgcaatttaccaacaggcatgatgttcgag |
39684080 |
T |
 |
| Q |
217 |
aaggttggaaaactgttcttaaactacattgg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39684079 |
aaggttggaaaactgttcttaaactacattgg |
39684048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University