View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_196 (Length: 249)
Name: NF6872A_low_196
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_196 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 6854944 - 6854706
Alignment:
| Q |
1 |
agaagagtttgtctggtagtttcaaggtttcggcaaaaattgactataatgaggagaagcagacctcaaaggacagatgggctggacttgcctatgatac |
100 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| || |
|
|
| T |
6854944 |
agaagagtttgtctggtaattttaaggtttcggcaaaaattgactataatgaggagaagcagacctcaaaggacagatgggctgggcttgcttatgacac |
6854845 |
T |
|
| Q |
101 |
ctcagatgaccaacaggatatcacaaggggaaagggaaaggtggacagtgtc-ttcaagctccaatggatgctggaactcactatgctgtcatgagttcc |
199 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6854844 |
ctcggatgaccaacaggatatcactaggggaaagggaaaggtggacagtgtctttcaagctccaatggatgctggaactcactatgctgtcatgagctcc |
6854745 |
T |
|
| Q |
200 |
tatgattatatcagtaccggtcttcgccagtaagttcat |
238 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6854744 |
tatgattatatcagtactggtcttcgccagtaagttcat |
6854706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University