View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6872A_low_202 (Length: 249)

Name: NF6872A_low_202
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6872A_low_202
NF6872A_low_202
[»] chr8 (2 HSPs)
chr8 (103-230)||(10597537-10597664)
chr8 (27-137)||(10597666-10597776)
[»] chr3 (1 HSPs)
chr3 (53-230)||(53388248-53388425)


Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 103 - 230
Target Start/End: Complemental strand, 10597664 - 10597537
Alignment:
103 ctttgctctctcacttgatgcagaatcaacatgcgaccgagattcacttccaccatcatcatccttcatacggaaatattccttgggacttccattacca 202  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| | ||||||||||||||||| || |    
10597664 ctttgttctctcacttgatgcagaatcaacatgcgaccgagattcacttctaccatcatcatccttcatacagaactgttccttgggacttccatcacta 10597565  T
203 gtaccttcagatgaatctttttctgatg 230  Q
    ||||||||||||||||||||||||||||    
10597564 gtaccttcagatgaatctttttctgatg 10597537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 27 - 137
Target Start/End: Complemental strand, 10597776 - 10597666
Alignment:
27 ttgtggagtccaatgcatcagcagcaattacaggactataatcttcgttgatgaatccgtttggtagcagtgtagtctttgctctctcacttgatgcaga 126  Q
    ||||||| ||| ||||||||||||| |||||||||||   ||| || ||||| ||||| |||||||||| ||| ||||||| |||||||||| |||||||    
10597776 ttgtggaatccgatgcatcagcagccattacaggactgctatcctcattgattaatccatttggtagcattgtggtctttgttctctcacttaatgcaga 10597677  T
127 atcaacatgcg 137  Q
    |||||||||||    
10597676 atcaacatgcg 10597666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 53 - 230
Target Start/End: Complemental strand, 53388425 - 53388248
Alignment:
53 attacaggactataatcttcgttgatgaatccgtttggtagcagtgtagtctttgctctctcacttgatgcagaatcaacatgcgaccgagattcacttc 152  Q
    |||||||||||| |||| || ||||| ||||| | |||||||| ||||| ||||| |||||||||||| | |||||||||||||||||||||||||||||    
53388425 attacaggactacaatcctcattgattaatccatctggtagcattgtaggctttgttctctcacttgacgtagaatcaacatgcgaccgagattcacttc 53388326  T
153 caccatcatcatccttcatacggaaatattccttgggacttccattaccagtaccttcagatgaatctttttctgatg 230  Q
    |||| ||||||||||||||||  || | ||||||||||||||| | || | |||||||||||||||||||||||||||    
53388325 caccgtcatcatccttcatacataattgttccttgggacttccctcactaataccttcagatgaatctttttctgatg 53388248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University