View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_203 (Length: 249)
Name: NF6872A_low_203
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_203 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 26872110 - 26871882
Alignment:
| Q |
19 |
ttactgtggtagcctaaagagaaaaatgtttctccttcacttttcttagtctcttacattcactactgtccaagagtagttcttaacaaaccatgttata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26872110 |
ttactgtggtagcctaaagagaaaaatgtttctccttcacttttcttagtctcttacattcactactgtccaagagtagttcttaacaaaccatgttata |
26872011 |
T |
 |
| Q |
119 |
tttctaaatgatatcacttcaagttctctaaatgcaatatccgctacctgcacccttttcttcactaagatagatttgtgtgagcgtgtgtagtgcgtgt |
218 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
26872010 |
tttccaaatgatatcacttcaagttgtctaaatgcaatatctgctacctgcacccttttcttcact-cgatagatttgtgtgagcgtgtgtagtgtgtgt |
26871912 |
T |
 |
| Q |
219 |
aatttccacatacctgaatatgtaatgatg |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
26871911 |
aatttccacgtacctgaatatgtaatgatg |
26871882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University