View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_208 (Length: 248)
Name: NF6872A_low_208
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_208 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 2694231 - 2694353
Alignment:
| Q |
1 |
gctgaaaagcttttggagatgtacaataacaaatggggaagcagcattgatcctgtgtttagagagtgttgctactgatcttgttttctggtgaaggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| ||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2694231 |
gctgaaaagcttttggagatgtacaataacaagtggggaagcaacatagattctgtgtttagagagtgttgctactgatcttgtcttctggtgaaggaga |
2694330 |
T |
|
| Q |
101 |
gaaaatgtagattgaaaataaca |
123 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
2694331 |
gaaaatgtagattggaaataaca |
2694353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 2687213 - 2687290
Alignment:
| Q |
1 |
gctgaaaagcttttggagatgtacaataacaaatggggaagcagcattgatcctgtgtttagagagtgttgctactga |
78 |
Q |
| |
|
||||| |||||||||||||||||||| || || |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2687213 |
gctgataagcttttggagatgtacaacaagaagtggggaagcaacattgatcctgtgtttagagagtgttgctactga |
2687290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 194 - 231
Target Start/End: Original strand, 2694408 - 2694445
Alignment:
| Q |
194 |
taaataatatctggaatctatgtccatatgtttgattt |
231 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
2694408 |
taaataatatcaggaatctatgtccatatgtttaattt |
2694445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University