View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_225 (Length: 244)
Name: NF6872A_low_225
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_225 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 5226170 - 5225938
Alignment:
| Q |
1 |
gtaaacttttatacatattgaaacctgaattttgaaatacacaagtttgtaaattttattgcagtaggtgtataatagtcttaaagagttggttactcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5226170 |
gtaaacttttatacatattgaaacctgaattttgaaatacacaagtttgtaaattttattgcagtaggtgtataatagtcttaaagagttggttactcaa |
5226071 |
T |
|
| Q |
101 |
ttgtaaattggaagagnnnnnnnnnnnnnnnttgcatcataaaatcacatccttaatttcggagtttggtcatgatagagattgttttgactttgatcca |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5226070 |
ttgtaaattggaagagaaaaaattaaaaaaattgcatcataaaatcacatccttaatttcggagtttggtcatgatagagattgttttgactttgatcca |
5225971 |
T |
|
| Q |
201 |
atttcattgcgggagcagcttaatgatgatgtc |
233 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
5225970 |
atttcattgtgggagcagcttaatgatgatgtc |
5225938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 136 - 228
Target Start/End: Complemental strand, 5189873 - 5189781
Alignment:
| Q |
136 |
atcataaaatcacatccttaatttcggagtttggtcatgatagagattgttttgactttgatccaatttcattgcgggagcagcttaatgatg |
228 |
Q |
| |
|
|||| |||||||||||||||||| | | | | ||||||| ||||||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
5189873 |
atcacaaaatcacatccttaattccatattacgatcatgatggagattgttttgaatttgatccaatttcattgtgggagcaacttaatgatg |
5189781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University