View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_235 (Length: 243)
Name: NF6872A_low_235
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_235 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 70 - 193
Target Start/End: Complemental strand, 10567007 - 10566884
Alignment:
| Q |
70 |
cttcttcctatattaactattaaggtattttgggtttgatgatgaaacattaatgacatctccttccccatttctccgataataacatttatggttgcat |
169 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
10567007 |
cttcttcatatattaactattagggtattttgggtttgatgatgaaacattaacgacatctccttccccatttctccaataatagcatctatggttgcat |
10566908 |
T |
|
| Q |
170 |
ccacttccccactactcttgcacg |
193 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
10566907 |
ccacttccccaatactcttgcacg |
10566884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 83 - 193
Target Start/End: Complemental strand, 45521467 - 45521357
Alignment:
| Q |
83 |
taactattaaggtattttgggtttgatgatgaaacattaatgacatctccttccccatttctccgataataacatttatggttgcatccacttccccact |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||| | |
|
|
| T |
45521467 |
taactattaaggtattttgggtttgatgatgaaacattaacgacatctccttccccatttctccaataatagcatctatggttgcatccacttccccaat |
45521368 |
T |
|
| Q |
183 |
actcttgcacg |
193 |
Q |
| |
|
||||||||||| |
|
|
| T |
45521367 |
actcttgcacg |
45521357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 99 - 185
Target Start/End: Original strand, 52727735 - 52727820
Alignment:
| Q |
99 |
ttgggtttgatgatgaaacattaatgacatctccttccccatttctccgataataacatttatggttgcatccacttccccactact |
185 |
Q |
| |
|
|||||||| ||| |||||| |||||||||||||||| |||||||||| | ||| ||| |||||||||||||||||||||| |||| |
|
|
| T |
52727735 |
ttgggtttaatggtgaaacgttaatgacatctccttttccatttctcc-agcatagcatctatggttgcatccacttccccaatact |
52727820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University