View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_237 (Length: 242)
Name: NF6872A_low_237
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_237 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 125 - 224
Target Start/End: Original strand, 5226339 - 5226438
Alignment:
| Q |
125 |
tcacattatatctaaaattatcaataatgtaagtgcatctatcctcaagctacattaatgccacaaaatcttctaaacaattctttcatttaatttagaa |
224 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
5226339 |
tcacattatatctaaaattatcaacaatgtaagtgcatctatcctcaagctacattaatgccataaattgttctaaacaattatttcatttaatttagaa |
5226438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 227
Target Start/End: Original strand, 5190756 - 5190800
Alignment:
| Q |
183 |
tgccacaaaatcttctaaacaattctttcatttaatttagaaatg |
227 |
Q |
| |
|
||||||||| | |||||||||||| |||||||||||| ||||||| |
|
|
| T |
5190756 |
tgccacaaattgttctaaacaattgtttcatttaattaagaaatg |
5190800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University