View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_238 (Length: 242)
Name: NF6872A_low_238
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_238 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 93 - 242
Target Start/End: Original strand, 43331257 - 43331406
Alignment:
| Q |
93 |
gctctaggagccgtttgaattttgatgatgtgtagattctggtcccttcaccttagaccattgatttagttttcatatagccggctaaattgtttttaat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43331257 |
gctctaggagccgtttgaattttgatgatgtgtagattatgttcccttcaccttagaccattgatttagttttcatatagccggctaaattgtttttaat |
43331356 |
T |
|
| Q |
193 |
tatgtgaccaaaattgtttgcctaattaaggtactctaagtaacttttat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43331357 |
tatgtgaccaaaattgtttgcctaattaaggtactctaagtaacttttat |
43331406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 194
Target Start/End: Original strand, 1048458 - 1048489
Alignment:
| Q |
163 |
tttcatatagccggctaaattgtttttaatta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1048458 |
tttcatatagccggctaaattgtttttaatta |
1048489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University