View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_241 (Length: 242)
Name: NF6872A_low_241
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_241 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 150 - 228
Target Start/End: Original strand, 39321685 - 39321763
Alignment:
| Q |
150 |
tcatggacttcttaacatgacatcttgaaaaagacaaacatttatcattgaaatagctagttagcgcaccattcagata |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39321685 |
tcatggacttcttaacatgacatcttgaaaaagacaaacatttatcattgaaatagctagttagcgcaccattcagata |
39321763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 149
Target Start/End: Original strand, 39321624 - 39321654
Alignment:
| Q |
119 |
tatagtattatctacattgacctcttctttg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39321624 |
tatagtattatctacattgacctcttctttg |
39321654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University