View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_249 (Length: 238)
Name: NF6872A_low_249
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_249 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 23 - 220
Target Start/End: Original strand, 16281604 - 16281801
Alignment:
| Q |
23 |
aggttagcattttcatttcacttgaaaattgagattctatgtgatttacgtgtttcaatttttgattgcgttgccgaatttcaaaattgcgaggttagtt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16281604 |
aggttagcattttcatttcacttgaaaattgagattctatgtgatttacgtgtttgaatttttgattgcgttgccgaatttcaaaattgcgaggttagtt |
16281703 |
T |
|
| Q |
123 |
tatgagttcacgttttgcttctccaatgaagagttgatgcgttttgatatttgcgtatattttgtgttgatcttcgtatgttactgttagattttcat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16281704 |
tatgagttcacgttttgcttctccaatgaagagttgatgcgttttgatctttgcgtatattttgtgttgattttcgtatgttactgttagattttcat |
16281801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 119
Target Start/End: Original strand, 16282876 - 16282963
Alignment:
| Q |
33 |
tttcatttcact-tgaaaattgagattctatgtgatttacgtgtttcaatttttgattgcgttgccgaatttcaaaattgcgaggtta |
119 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| | ||| ||| ||| |||||||| |||||||||||| ||||||| ||||||| |
|
|
| T |
16282876 |
tttcattttactctgaaaattgagattctatgtgctcgtcgtttttgaatatttgattgtgttgccgaattttaaaattgtgaggtta |
16282963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 33 - 123
Target Start/End: Original strand, 16281423 - 16281514
Alignment:
| Q |
33 |
tttcatttcact-tgaaaattgagattctatgtgatttacgtgtttcaatttttgattgcgttgccgaatttcaaaattgcgaggttagttt |
123 |
Q |
| |
|
|||||||| ||| ||| ||||| ||||||||||| ||||||||||| ||||||||| || || |||| ||| ||||||| ||| ||||||| |
|
|
| T |
16281423 |
tttcattttactctgacaattgtgattctatgtgctttacgtgtttgaatttttgactgtgtcgccggctttgaaaattgtgagcttagttt |
16281514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 159
Target Start/End: Original strand, 16283802 - 16283861
Alignment:
| Q |
98 |
gaatttcaaaattgcgaggttagtttatgagttcacgttttgcttctccaatgaagagttga |
159 |
Q |
| |
|
|||| ||||||||| |||||||||||| |||||| |||||| |||||||||||||| |||| |
|
|
| T |
16283802 |
gaatatcaaaattgtgaggttagttta--agttcatgttttgattctccaatgaagaattga |
16283861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University