View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_256 (Length: 236)
Name: NF6872A_low_256
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_256 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 47 - 202
Target Start/End: Original strand, 45922788 - 45922943
Alignment:
| Q |
47 |
ccaaacatgcaatatgcaagatgtatgatttgccgcgtctggtctagaggatgaaacgaaatgaaaacttacattgcagaacaaaatggatgctcagcca |
146 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45922788 |
ccaaacatacaatatgcatgatgtatgatttgccgcttctggtctagaggatgaaacgaaatgaaaacttacattgcagaacaaagtggatgctcagcca |
45922887 |
T |
 |
| Q |
147 |
tttcgaactcttcactaagcaaggaggaggaatgcaggttattgtttatttatttt |
202 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
45922888 |
tttcgaactcttcgctaagcaaggaggaggaatgcaagttattgtttttttttttt |
45922943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University