View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_260 (Length: 234)
Name: NF6872A_low_260
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_260 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 26 - 164
Target Start/End: Complemental strand, 38207799 - 38207661
Alignment:
| Q |
26 |
cagagacagtacgtttttggcgtgagactgagtctgagtgtgctaaaaacactcttaaaactttccctctttcgtcttccactctttttcctttacactt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38207799 |
cagagacagtacgtttttggcgtgagactgagtctgagtgtgctaaaaacactcttaaaactttccctctttcgtcttccactctttttcctttacactt |
38207700 |
T |
 |
| Q |
126 |
catttcattctataaattgcaactccactacatttttct |
164 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38207699 |
catttcattctataaattgctactccactacatttttct |
38207661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University