View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_292 (Length: 230)
Name: NF6872A_low_292
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_292 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 51 - 230
Target Start/End: Original strand, 8905489 - 8905668
Alignment:
| Q |
51 |
attggtgtccacccccttataatactattaaaattaactgtgatggatcctctgtaggtacccagccttatggtgcgattggtattgttttcagagatta |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8905489 |
attggtgtccacccccttataatactattaaaattaactgtgatggatcctctataggtaaccagccttgtggtgcgattggtattgttttcagagatta |
8905588 |
T |
|
| Q |
151 |
gagggccaatttattgggagcttttgctggtaatataggtcatgcttctgctattgaagcagaattctctgcctgtatga |
230 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8905589 |
cagggccaatttcttgggagcttttgctagtaatataggtcatgcttctgctattgaagcagaattctctgcctgtatga |
8905668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University