View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_300 (Length: 228)
Name: NF6872A_low_300
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_300 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 23 - 211
Target Start/End: Complemental strand, 55370213 - 55370025
Alignment:
| Q |
23 |
acttcaacactcccgcttatttcaaattatctaggctaatcacatgcatcttcctcatgtctttgaacttttctatcttcaatggcttggtaagaacatc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55370213 |
acttcaacactcccgcttatttcaaattctctaggctaatcacatgcatcttcctcatgtctttgaacttttctatcttcaatggcttggtaagaacatc |
55370114 |
T |
 |
| Q |
123 |
tgcagcttgatcatcagtcttacagtagcttagagtgatccttcccgtgttgacttgatctctaaggaagtgaaacttgacctctatgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55370113 |
tgcagcttgatcatcagtcttacagtagcttagagtgatccttcccgtgttgacttgatctctaaggaagtgaaacttgacctcaatgt |
55370025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University