View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_303 (Length: 228)
Name: NF6872A_low_303
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_303 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 49294096 - 49293874
Alignment:
| Q |
1 |
tgaattgaataccactgagatggagtctggatattgaatcaacaaatcttgaagaactagatccaaaacctnnnnnnnnnnnnnnnnnnnnnnnttaaac |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49294096 |
tgaattgaataccactgaaatggagtctggatattgaatcaacaaatcttgaagaactagatccaaaacctaaaaagaaaaaagaaaagaaaaattaaac |
49293997 |
T |
 |
| Q |
101 |
ggaaaatgaattagaaaccctttaagtatatgtagatgtgtgaggaaaacataccgcaagcttgccggagccacggggaccgagaagaagaatagaattg |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49293996 |
ggaaaatgaattagaaacccattaagtatatgtagatgtgtgaggaaaacataccgcaagcttgccggagccacggggaccgagaagaagaatagaattg |
49293897 |
T |
 |
| Q |
201 |
ttgcatgcttcagcgacggaagt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49293896 |
ttgcatgcttcagcgacggaagt |
49293874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University