View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_315 (Length: 224)
Name: NF6872A_low_315
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_315 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 22 - 154
Target Start/End: Complemental strand, 38207793 - 38207661
Alignment:
| Q |
22 |
cagtacgtttttggcgtgagactgagtctgagtgtgctaaaaacactcttaaaactttccctctttcgtcttccactctttttcctttacacttcatttc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38207793 |
cagtacgtttttggcgtgagactgagtctgagtgtgctaaaaacactcttaaaactttccctctttcgtcttccactctttttcctttacacttcatttc |
38207694 |
T |
|
| Q |
122 |
attctataaattgcaactccactacatttttct |
154 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
38207693 |
attctataaattgctactccactacatttttct |
38207661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University