View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_319 (Length: 222)
Name: NF6872A_low_319
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_319 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 37 - 222
Target Start/End: Complemental strand, 41793304 - 41793119
Alignment:
| Q |
37 |
cctgtggctggagatgaggagaggattatcgagatttctgacacgcgccgccgtgatccggatggtagaatgccacagttttcgccggcgcaggaggcgt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41793304 |
cctgtggctggagatgaggagaggattatcgagatttctgacacgcgccgccgtgatccggatggtagaatgccacagttttcgccggcgcaggaggcgt |
41793205 |
T |
|
| Q |
137 |
tgcttctcattcatgagaggctgttggagaacgatccggggtttgaggatgaggaggactacggcggcggaagaggtggtggtggg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41793204 |
tgcttctcattcatgagaggctgttggagaacgatccggggtttgaggatgaggaggactacggcggcggaagaggtggtggtggg |
41793119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University