View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_326 (Length: 219)
Name: NF6872A_low_326
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_326 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 219
Target Start/End: Complemental strand, 53097340 - 53097128
Alignment:
| Q |
7 |
tgcctatgatggttaagagtgaaaatggttgcaaagttgaagtgcatgactctgaattgtctattgaaatggggtgtgtagtttttaagttgcattgtgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53097340 |
tgcctatgatggttaagagtgaaaatggttgcaaagttgaagtgcatgactctgaattgtctattgaaatggggtgtgtagtttttaagttgcattgtgt |
53097241 |
T |
|
| Q |
107 |
gaaatctctattttcaaattctttttcatatttatttattgtgttttgtcatcatattgcagattaaatgtgtccacagaatcacaattttcacatattg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53097240 |
gaaatctctattttcaaattctttttcatatttatttattgtgttttgtcatcatattgcagattaaatgtgtccacagaatcgcaattttcacatattg |
53097141 |
T |
|
| Q |
207 |
ggggaaaagtaga |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
53097140 |
ggggaaaagtaga |
53097128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University