View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_334 (Length: 216)
Name: NF6872A_low_334
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_334 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 22 - 133
Target Start/End: Complemental strand, 29427887 - 29427776
Alignment:
| Q |
22 |
acataatgtacgattgtgcattcatttagttaccactcatctagaaaaccttcactagggacgtttctgttgtaccattttgtatcccgtgttaatcacc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29427887 |
acataatgtacgattgtgcattcatttagttaccactcatctagaaaaccttcactagggacgtttctgttgtaccattttgtatcccgtgttaatcacc |
29427788 |
T |
 |
| Q |
122 |
aacccttttcat |
133 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29427787 |
aacccttttcat |
29427776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University