View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_341 (Length: 213)
Name: NF6872A_low_341
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_341 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 36603881 - 36603711
Alignment:
| Q |
20 |
ctggggctattgtgctgcaacccatttacttaaagaagtcaagtgaccaagatgtgaagattaagtttagcttaagaaattcttccaccaaatcagctta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36603881 |
ctggggctattgtgctgcaacccatttacttaaagaagtcaagtgaccaagatgtgaagattaagtttagcttaagaaattcttccaccaaatcagctta |
36603782 |
T |
|
| Q |
120 |
taaggctgtttctcatgatttggttaatgattggaataaagggatagtgaactttgatgtgaaaatgttgg |
190 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36603781 |
taaggctgtttctcatggtttggttaatgattggaataaagggatagtgaactttgatgtgaaaatgttgg |
36603711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 132 - 174
Target Start/End: Complemental strand, 36599477 - 36599435
Alignment:
| Q |
132 |
tcatgatttggttaatgattggaataaagggatagtgaacttt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
36599477 |
tcatgatttggttaatgattggaataaagggatactgtacttt |
36599435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University