View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6872A_low_351 (Length: 204)

Name: NF6872A_low_351
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6872A_low_351
NF6872A_low_351
[»] chr2 (1 HSPs)
chr2 (19-190)||(41386973-41387147)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 41386973 - 41387147
Alignment:
19 gtagaaatagatgtaataagtaatggtgagaaaatttaacatgnnnnnnnna---aaattgtttggaattgcacttggtgttgtctttcaatgcagtgag 115  Q
    ||||||||||||||||||||||||||||||||||||||| |||            |||||||||||||||||||||||||||||||||||||||| ||||    
41386973 gtagaaatagatgtaataagtaatggtgagaaaatttaagatgttttttttttttaaattgtttggaattgcacttggtgttgtctttcaatgcactgag 41387072  T
116 aaggaatgtatggtttgtgcagattttgaaagacaatggcagacgcggaggatattcagccactggtctatgata 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||    
41387073 aaggaatgtatggtttgtgcagattttgaaagacaatggcagacgccgaggatattcagccactggtctgtgata 41387147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University