View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_86 (Length: 315)
Name: NF6872A_low_86
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_86 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 7 - 312
Target Start/End: Complemental strand, 31557330 - 31557026
Alignment:
| Q |
7 |
ataagcaactgaagagtgcagtgtaactcaacataacattaattagatcagcaataatnnnnnnnctaatcatgtacctgccatctccatggattgaagg |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31557330 |
ataagcaactgaagagtgtagtgtaactcaacataacattaattagatcagcaataataaaaaa-ctaatcatgtacctgccatctccatggattgaagg |
31557232 |
T |
|
| Q |
107 |
tgcgagcatctttgaaatgttcaggattcaaatgcacagcacgaaatgatgcaatcaccttcattcccttaggaattgtgtaacctattattacaaagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31557231 |
tgcgagcatctttgaaatgttcaggattcaaatgcacagcacgaaatgatgcaatcaccttcattcccttaggaattgtgtaacctattattacaaagtg |
31557132 |
T |
|
| Q |
207 |
gggcattgtaaattgacatgtgctttgtctattatatgatataatattattgactatatagtcaatacagttttattttcttatagtaccttttatgtcg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31557131 |
gggcattgtaaattgacatgtgctttgtctattatatgatataatattattgactatatagtcaatacagttttattttcttatagtaccttttatgtcg |
31557032 |
T |
|
| Q |
307 |
atgtct |
312 |
Q |
| |
|
|||||| |
|
|
| T |
31557031 |
atgtct |
31557026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 81 - 160
Target Start/End: Complemental strand, 35479046 - 35478967
Alignment:
| Q |
81 |
tacctgccatctccatggattgaaggtgcgagcatctttgaaatgttcaggattcaaatgcacagcacgaaatgatgcaa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| || || || | ||| || |||||||||||||||| |
|
|
| T |
35479046 |
tacctgccatctccatggattgaaggtgcgcgcatctttgaaatgatcggggtttagatgtacggcacgaaatgatgcaa |
35478967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University