View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6872A_low_97 (Length: 302)
Name: NF6872A_low_97
Description: NF6872A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6872A_low_97 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 41735180 - 41734876
Alignment:
| Q |
1 |
tcaatttaattgcgaaaatgtcttttatcttgtaattcccatttttcactagtgatgggcgatagtcatatattcttcacaccaattcaatatatagttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735180 |
tcaatttaattgcgaaaatgtcttttatcttgtaattcccattttgcactagtgatgggcgatagtcatatattcttcacaccaattcaatatatagttg |
41735081 |
T |
 |
| Q |
101 |
gcctaat---cagattggtaatctaccatatgccaaccttggtagagtatttatacacttttaccatccatcttgacatcaccaattcaatctgccactg |
197 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735080 |
gcctaatgatcagattggtaatctaccatatgccaaccttggtagagtatttatacacttttaccatccatcttgacatcaccaattcaatctgccactg |
41734981 |
T |
 |
| Q |
198 |
atcataatatgatgaagcaaaatctattggtgaaaataatcactcttctcccttggcttattcttttcttcattctaacaggtactcataatttgctagc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41734980 |
atcataatatgatgaagcaaaatctattagtgaaaataatcactcttctcccttggcttattcttttcttcattataacaggtactcataatttgctagc |
41734881 |
T |
 |
| Q |
298 |
atctc |
302 |
Q |
| |
|
||||| |
|
|
| T |
41734880 |
atctc |
41734876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University