View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6873A_high_19 (Length: 212)
Name: NF6873A_high_19
Description: NF6873A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6873A_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 42 - 190
Target Start/End: Original strand, 25931960 - 25932108
Alignment:
| Q |
42 |
taacactggttatcactatcatccacactgtccaatataacttgttcattgctatctccatcatatcacccctctctctttttgtgctcacactgaaatg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25931960 |
taacactggttatcactatcatccacactgtccaatataacttgttcattgctatctccatgatatcacccctctctctttttgtgctcacactgaaatg |
25932059 |
T |
|
| Q |
142 |
tttgatttatactcccgagttttatacacttttactatttgacaagtgt |
190 |
Q |
| |
|
|||||||||||||| | | |||||||||||||| ||||||||||||||| |
|
|
| T |
25932060 |
tttgatttatactctcaaattttatacactttttctatttgacaagtgt |
25932108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University