View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6873A_low_105 (Length: 250)
Name: NF6873A_low_105
Description: NF6873A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6873A_low_105 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 246
Target Start/End: Original strand, 45929488 - 45929717
Alignment:
| Q |
17 |
gagaagaccctgaagcatgtcaatcatatttgagaatgagaaaccgggatggaaagtacaatcttatgtttgaggttaggtcattgaaaacacacttgtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45929488 |
gagaagaccctgaagcatgtcaatcatatttgagaatgagaaaccgggatggaaagtacaatcttatgtttgaggttaggtcattgaaaacacacttgtc |
45929587 |
T |
|
| Q |
117 |
tgaattggtgatatgatatgtatttattttatgccaatgcttcactcataatagtgctcttgtccttctgctgtgagataaaaaattgtcctatcttttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45929588 |
tgaattggtgatatgatatgtatttattttatgccaatgcttcactcataatagtgctcttgtccttctgctgtgagataaaaaatagtcctatcttttt |
45929687 |
T |
|
| Q |
217 |
gagcaagcagttttctactctttgtttctt |
246 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
45929688 |
gagcaagcagttttctactctttatttctt |
45929717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University