View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6873A_low_127 (Length: 245)
Name: NF6873A_low_127
Description: NF6873A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6873A_low_127 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 22 - 234
Target Start/End: Complemental strand, 26933652 - 26933440
Alignment:
| Q |
22 |
catagtgggtccattatttttgggtcgagacaacacaagttttgagatgttatttccaacagcaagcataatgatactttcaacatttgcagaatttgga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26933652 |
catagtgggtccattatttttgggtcgagacaacacaagttttgagatgttatttccaacagcaagcataatgatactttcaacatttgcagaatttgga |
26933553 |
T |
|
| Q |
122 |
atgataatttatttctttaagatgggggtgcaaataaactctaaacagatttttatggttgagaagcgtgcagtaataattgtaatattaggccacttat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
26933552 |
atgataatttatttctttaagatgggggtgcaaataaactctaaacagatttttatggttgagaagcgtgcagtaataattggaatatcaggccacttat |
26933453 |
T |
|
| Q |
222 |
cttctatgctact |
234 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
26933452 |
cttctatggtact |
26933440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University