View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6873A_low_154 (Length: 229)
Name: NF6873A_low_154
Description: NF6873A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6873A_low_154 |
 | |
|
| [»] scaffold0009 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 35 - 207
Target Start/End: Complemental strand, 40183 - 40010
Alignment:
| Q |
35 |
agatcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcacacacg- |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40183 |
agatcaagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcacacacga |
40084 |
T |
|
| Q |
134 |
aaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgttgttttgctgcttca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40083 |
aaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaacaccgcgtcgttttgctgcttca |
40010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 86 - 205
Target Start/End: Complemental strand, 33511 - 33391
Alignment:
| Q |
86 |
ggtacatttaatctatccaatttgaggaccacaagtgtttcacacacg-aaatggtaggtgacaacatcacttgtaacatgcatagatagagatcctcaa |
184 |
Q |
| |
|
|||||| ||| ||||||||||||||| ||||||||||||||||||||| |||||||||| ||||| |||||| || ||||||||||||||||||||| | |
|
|
| T |
33511 |
ggtacaattattctatccaatttgagaaccacaagtgtttcacacacgaaaatggtaggcgacaaggtcacttctaccatgcatagatagagatcctcga |
33412 |
T |
|
| Q |
185 |
caccgcgttgttttgctgctt |
205 |
Q |
| |
|
| || ||| |||||||||||| |
|
|
| T |
33411 |
ccccacgtcgttttgctgctt |
33391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 40 - 129
Target Start/End: Original strand, 19970209 - 19970298
Alignment:
| Q |
40 |
aagggttttaagcgaaggaagatcaaccgaaaagcgagacatagagggtacatttaatctatccaatttgaggaccacaagtgtttcaca |
129 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| | ||| |||||| | ||||| || ||| |||||| || ||||||||||||||||| |
|
|
| T |
19970209 |
aagggttttgagcgaaggaagatcaacagaagaacgaaacatagttgttacatgtatgctaaacaatttcagaaccacaagtgtttcaca |
19970298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University