View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6873A_low_164 (Length: 222)
Name: NF6873A_low_164
Description: NF6873A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6873A_low_164 |
 | |
|
| [»] scaffold0530 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0530 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: scaffold0530
Description:
Target: scaffold0530; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 23 - 208
Target Start/End: Complemental strand, 8046 - 7861
Alignment:
| Q |
23 |
ataaatggcagggattgggtactgcaattgttaaggcaacaaactttgatcatgcattgccaaaggaaaaacatattcgatgtatatcgtattcttgttc |
122 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8046 |
ataaatggcagggattggatactgcaattgttaaggcaacaaactttgatcatgcattgccaaaggaaaaacatattcgatgtatatcgtattctttttc |
7947 |
T |
|
| Q |
123 |
ttttattcaatgcaatgcaattgatccttagttacaagctttgttggagaatgtatgtgaagcgtataaagattgtatgttgatgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7946 |
ttttattcaatgcaatgcaattgatccttagttacaagctttgttggagaatgtatgtgaagagtataaagattgtatgttgatgt |
7861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University