View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6873A_low_169 (Length: 219)
Name: NF6873A_low_169
Description: NF6873A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6873A_low_169 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 2 - 219
Target Start/End: Original strand, 6757748 - 6757965
Alignment:
| Q |
2 |
tgaacaaatattgtctgagtgatttaaatcttgnnnnnnnncttccataaatnnnnnnntagttgcatttataatttaaatgtccctagagctatgcaag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6757748 |
tgaacaaatattgtctgagtgatttaaatcttgttttttttcttccataaataaaaaaatagttgcatttataatttaaatgtccctagagctatgcaag |
6757847 |
T |
 |
| Q |
102 |
tataatgcagtagattgtcttaggatttggacacatactttagttgttgccttttaaaatatgtctgatcatagttctttggaacactaatatttgctct |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6757848 |
tataatgcagtaaattgtcttaggatttggacacatactttagttgttgccttttaaaatatgtctgatcatagttctttggaacactaatatttgctct |
6757947 |
T |
 |
| Q |
202 |
gaactgctaatatcagga |
219 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6757948 |
gaactgctaatatcagga |
6757965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University