View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6873A_low_187 (Length: 207)

Name: NF6873A_low_187
Description: NF6873A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6873A_low_187
NF6873A_low_187
[»] chr3 (1 HSPs)
chr3 (18-88)||(54828042-54828112)


Alignment Details
Target: chr3 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 54828112 - 54828042
Alignment:
18 tgggtgatgggttgcagttgccgtagggtggtgacctgcacctggaatactggttgcactattatgctcct 88  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54828112 tgggtgatgggttgcagttgccgtagggtggtgacctgcacctggaatactggttgcactattatgctcct 54828042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University