View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6873A_low_58 (Length: 295)
Name: NF6873A_low_58
Description: NF6873A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6873A_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 8 - 290
Target Start/End: Complemental strand, 37768515 - 37768235
Alignment:
| Q |
8 |
ttggtgttgacattttacaaaggagtagaatttgatatttggccttttgcaatcaatcttttggatccaaagaacgaccacacggaacgtgtcactgata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37768515 |
ttggtgttgacattttacaaaggagtagaatttgatatttggccttttgcaatcaatattttggatccaaagaacgaccacacggaacatgtcactgata |
37768416 |
T |
 |
| Q |
108 |
ctaccactgaattgttaggtgttctatgtgtcttactcagttgcttctgtttctcaatctggctcattattcaggtaattaattagttactaaacacaac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37768415 |
ctaccactgaattgttaggtgttctatgtgtcttactcagttgcttctgtttctcaatctggctcatcattcaggtaattaattagttactaaacacaac |
37768316 |
T |
 |
| Q |
208 |
a---ttatgatcaacttaattaattattgtctatttattgttttattttaatttacatggcataggctaagatcagtgaagtatat |
290 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37768315 |
attattatgatcaacttaattaattattgtctatttattg-----ttttaatttacatggcataggctaagatcagtgaagtatat |
37768235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University