View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6873A_low_95 (Length: 255)
Name: NF6873A_low_95
Description: NF6873A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6873A_low_95 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 249
Target Start/End: Original strand, 16637938 - 16638181
Alignment:
| Q |
6 |
gtttggtgatgaaaaatccatttggtcaagtgaatatacgtttgcaaacctnnnnnnntgggtacactttggcgagttgaaaattttgttttgatcactc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
16637938 |
gtttggtgatgaaaaatccatttggtcaagtgaatatacgtttgcaaacctaaaaaaaccggtgcattttggcgagttgaaaattttgttttgatcactc |
16638037 |
T |
 |
| Q |
106 |
tttttggcaagtggcagtgatggctaacaaacaggtacactttggcaacaggtattagaagcaaaacaagttgaatttttgtgttctttaacaaaattga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
16638038 |
tttttggcaagtggcagtgatggctaacaaacaggtacactttggcaacaggtattaaaagcaaaacaagttgaatttctgtcttctataacaaaattga |
16638137 |
T |
 |
| Q |
206 |
acgaggtcgatagatccttatgtgtctgtcgacttggtggaaag |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16638138 |
acgaggtcgatagatccttatgtgtctgtcgacttggtggaaag |
16638181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University