View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_high_33 (Length: 232)
Name: NF6874A_high_33
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 31792670 - 31792477
Alignment:
| Q |
17 |
ttggtgtttcttccaaattgtaaaccatggagtgagtcatgatttgatggacaaagctagggaaacttggcgtcaattctttcacttgcctatggaggct |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31792670 |
ttggggtttcttccaaattgtaaaccatggagtgagtcctgatttgatggacaaagctagggaaacttggcgtcaattctttcacttgcctatggaggct |
31792571 |
T |
|
| Q |
117 |
aagcaacaatatgcaaactctccaacaacttatgaagggtatggaagtagacttggtgttgagaaaggggctattcttgattggagtgattact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31792570 |
aagcaacaatatgcaaactctccaacaacttatgaagggtatggaagtagacttggtgttgagaaaggggctattcttgattggagtgattact |
31792477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 24 - 210
Target Start/End: Complemental strand, 35617468 - 35617282
Alignment:
| Q |
24 |
ttcttccaaattgtaaaccatggagtgagtcatgatttgatggacaaagctagggaaacttggcgtcaattctttcacttgcctatggaggctaagcaac |
123 |
Q |
| |
|
||||| |||||||| |||||||| || || |||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||| | || ||| |
|
|
| T |
35617468 |
ttctttcaaattgttaaccatggtgttagccatgatttgatggatttagctaaggaaacttggcgtcaattttttcacttgcctatggaagtgaaacaat |
35617369 |
T |
|
| Q |
124 |
aatatgcaaactctccaacaacttatgaagggtatggaagtagacttggtgttgagaaaggggctattcttgattggagtgattact |
210 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
35617368 |
tatatgcaaactcaccaaaaacttatgaagggtatggtagtagacttggtgttaagaaaggtgctattcttgattggagtgattact |
35617282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University