View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_101 (Length: 276)
Name: NF6874A_low_101
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_101 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 21832015 - 21831747
Alignment:
| Q |
1 |
atactaataggatgcataatttcatgataatcagcattcgtctcttacatcaaatatggtatcaacaaaacaagttcatcttatagagatctcatcaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832015 |
atactaataggatgcataatttcatgataatcagcattcgtctcttacaccaaatatggtatcaacaaaacaagttcatcttatagagatctcatcaacc |
21831916 |
T |
|
| Q |
101 |
acatggagttcgaacttgaaataacctgaaaatacatttaaaataagcnnnnnnnnnnnnnnctttgtagaccgataaaaacatcaatgaggacattaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21831915 |
acatggagttcgaacttgaaataacctgaaaatacatttaaaataagc-aaaaaaaaaaaaactttgtagaccgataaaaacatcaatgaggacattaga |
21831817 |
T |
|
| Q |
201 |
tctcaaacatggtattaatggagtgatcagataccacgatcgctttcgaggagggcacttggataccaag |
270 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21831816 |
tctcaaacatggtattaatggagtgatcaaataccacgatggctttcgaggagggcacttggataccaag |
21831747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University