View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_114 (Length: 262)
Name: NF6874A_low_114
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_114 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 6 - 257
Target Start/End: Complemental strand, 15695206 - 15694955
Alignment:
| Q |
6 |
aataatatcctttgacttttctaaaatatctatcaatacaaacacatgaagagtggacttggtaaacataaattcatgactcaaattttctatcattaca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695206 |
aataatatcctttgacttttctaaaatatctatcaatacaaacacatgaagagtggacttggtaaacataaattcatgactcaaattttctatcattaca |
15695107 |
T |
 |
| Q |
106 |
gcatcatttgctttggacttctaaatataatagctcaattatcattacaacatcattggcaataattggaatcatgcaataggaacatagtactccatgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695106 |
gcatcatttgctttggacttctaaatataatagctcaattatcattacaacatcattggcaataattggaatcatgcaataggaacatagtactccatgg |
15695007 |
T |
 |
| Q |
206 |
aaggaagaaaactaaacttgacatcaatattttttgctttcatactatatat |
257 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15695006 |
aaggaagaaaactaaacttgagatcaatattttttgctttcatactatatat |
15694955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University