View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6874A_low_12 (Length: 433)

Name: NF6874A_low_12
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6874A_low_12
NF6874A_low_12
[»] chr4 (1 HSPs)
chr4 (8-198)||(409643-409833)


Alignment Details
Target: chr4 (Bit Score: 167; Significance: 3e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 8 - 198
Target Start/End: Original strand, 409643 - 409833
Alignment:
8 tggtgttgggattgataatgtggatctacaagctgctactgaatttggttgtcttgttgtgaatgctcctacagctaatactattgctgctgctgaacat 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
409643 tggtgttgggattgataatgtggatctacaagctgctactgaatttggttgtcttgttgtgaatgctcctactgctaatactattgctgctgctgaacat 409742  T
108 gggattgctcttcttgctgctatggctcgtaacgtttctcaagctgatgcttcccttaaagcagggatggtacctgttcatgatttatctt 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| | | |||||||||||||    
409743 gggattgctcttcttgctgctatggctcgtaacgtttctcaagctgatgcttcccttaaagctggtatggtacatttacatgatttatctt 409833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University