View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_120 (Length: 258)
Name: NF6874A_low_120
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_120 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 10695272 - 10695021
Alignment:
| Q |
1 |
gttagggaaactagggttagtaaatgtgtgagcaacggtgaagaagctgattccgnnnnnnnnn-tcttctctatatgtttttgaaaatctgcatctaga |
99 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10695272 |
gttagggaaactagggttagtacatgtgtgagcaacggtgaagaagctgattccgaaaaaaaaaatcttctctatatgtttttgaaaatctgcatctaga |
10695173 |
T |
|
| Q |
100 |
aaattatattttgctcttggtcatgatcaagcaaagtgaaggatgaatcttaatgattcatgttatttggctctgggacatttatagtgtatttgcaacc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10695172 |
aaattatattttgctcttggtcatgatcaagcaaagtgaaggatgaatcttaatgattcatgttatttggctctgggacatttatattgtatttgcaacc |
10695073 |
T |
|
| Q |
200 |
agtaaatcataaggtataattcatagattttttgctagtctaagatcccagt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10695072 |
agtaaatcataaggtataattcatagattttttgctagtctaagatcccagt |
10695021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University