View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_132 (Length: 252)
Name: NF6874A_low_132
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_132 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 16385450 - 16385195
Alignment:
| Q |
1 |
atattatgcagtggctttaacaactgaactaaattcatatagacaatctaattagaatgtttcatatcacaataaagttatcaaaattgcggtggctcac |
100 |
Q |
| |
|
|||||||||| || ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16385450 |
atattatgcattgtctttaccaacttaactaaattcatatagacaatctaattagaatgtttcatatcacaatatagttatcaaaattgcggtggctcat |
16385351 |
T |
|
| Q |
101 |
tgttattacagcaaagttgtcgtgataccgaac----attagttgaaataaacacgacaaatgtttctaatgagcttcttagttaggtgcttgctttaca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16385350 |
tgttattacagcaaagttgtcgtgataccgaacattaattagttgaaataaacatgacaaatgtttctaatgagcttcttagttaggtgcttgctttaca |
16385251 |
T |
|
| Q |
197 |
agtagtatggcttataatcgtgttgtttcacgatctattttatgtgttgctctctg |
252 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
16385250 |
agcagtatggcttataatcgtgttgattcacgatctattttatgtgttgctttctg |
16385195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University