View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_147 (Length: 250)
Name: NF6874A_low_147
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_147 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 21469222 - 21469462
Alignment:
| Q |
10 |
gatgaaagagattaaacaggagagagatgaatgtgtgaaagttttcgatggatcttctacaaatgatcaacatgaaagtaatcgttctaacgaagaacaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21469222 |
gatgaaagagattaaacaggagagagatgaatgtgtgaaagttttcgatggatcttctacaaatgatcaacatgaaagtaatcgttctaacgaagaacaa |
21469321 |
T |
|
| Q |
110 |
gtcgaagggatgaaacattcatgtccaacatcaagcagcagcaacacaaatatgaaattgcattactcttctaatagttctacaacactaaagtaacttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21469322 |
gtcgaagggatgaaacattcatgtccaacatcaagcagcagcaacacaaatatgaaattgcattactcttctaatagttctacaacactaaagtaacttt |
21469421 |
T |
|
| Q |
210 |
gaaatagttactaacagcaatgtgactagggaactagaatt |
250 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21469422 |
gaaatagttaataacagcaatgtgactagggaactagaatt |
21469462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University