View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_155 (Length: 249)
Name: NF6874A_low_155
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_155 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 21 - 249
Target Start/End: Original strand, 39629950 - 39630173
Alignment:
| Q |
21 |
atgtgggtggtgaactggtgatcttggaaagtaaatgttgaaagtgtgttataagttgtgagcttccatggcaagatggtaagttggaatcgaaacatta |
120 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
39629950 |
atgtgggtggtgaactagtgatcttggaaagtaaatgttgaaagtgtgttataagttgtgagcttccatg-----atggtaagttgaaatcgaaacatta |
39630044 |
T |
|
| Q |
121 |
aaaaaccaccttgagttcctatttctccaagaccaccaaacaccaacaacaaagaagttggaactcgaagaagctagccagcatttaaaacaattgacaa |
220 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39630045 |
aaaaaacaacttgagttcctatttctccaagaccaccaaacaccaacaacaaagaagttggaactcgaagaagctagccagcatttaaaacaattgacaa |
39630144 |
T |
|
| Q |
221 |
tgtatgggtttgagacaaatttaaatgag |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39630145 |
tgtatgggtttgagacaaatttaaatgag |
39630173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University