View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_173 (Length: 243)
Name: NF6874A_low_173
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_173 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 20 - 133
Target Start/End: Complemental strand, 2875599 - 2875486
Alignment:
| Q |
20 |
cataccaagtttctatcatcactcaagtgaggattgagcaatcttagaaaaatagggctacttgctgaagtaagtgggggtggttcttaccaagtttcca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2875599 |
cataccaagtttctatcatcactcaagtgaggattgagcgatcttacaaaaatagggctacttgctgaagtaagtgggggtggttcttaccaagtttcca |
2875500 |
T |
|
| Q |
120 |
tcataatccaaaaa |
133 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2875499 |
tcataatccaaaaa |
2875486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University