View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6874A_low_195 (Length: 236)
Name: NF6874A_low_195
Description: NF6874A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6874A_low_195 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 4 - 236
Target Start/End: Original strand, 38322605 - 38322837
Alignment:
| Q |
4 |
atgtgttagccataaagtacaaccctgattggcaaaaagtgcaggttcatttttctatactaaatggtcaatgttatcatatttatgaacttatgatctt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38322605 |
atgtgttagccataaagtacaaccctgattggcaaaaagtgcaggttcatttttctatactatatggtcaatgtaatcatatttatgaacttatgatctt |
38322704 |
T |
|
| Q |
104 |
attaattaatagtagcaaataatgttgaatgtatttgtgcagctgaaagaaaacaaaggatatcgacttgtcgaaagtgatgctcaaataaatgcctcaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38322705 |
attaattaatagtagcaaataatgttgaatgtatttgtgcagctgaaagaaaacaaaggatatcgacttgtcgaaagtaatgctcaaataaatgcctcaa |
38322804 |
T |
|
| Q |
204 |
tttcagaatctaaagtccatccttcagagattg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38322805 |
tttcagaatctaaagtccatccttcagagattg |
38322837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University